Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTCCAGGGTGGGGTACATGCGGCA[G/T]CAGGCCACGCACTTGTAGCCATTCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
3 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605551 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C1orf111 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C1orf111 - chromosome 1 open reading frame 111 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_182581.3 | 628 | Nonsense Mutation | TGA,TGC | *,C 188 | NP_872387.2 | |
XM_005245103.3 | 628 | Nonsense Mutation | TGA,TGC | *,C 150 | XP_005245160.1 | |
XM_011509443.2 | 628 | Nonsense Mutation | TGA,TGC | *,C 207 | XP_011507745.1 | |
XM_011509444.1 | 628 | Nonsense Mutation | TGA,TGC | *,C 138 | XP_011507746.1 | |
XM_011509445.2 | 628 | Intron | XP_011507747.1 |
C1orf226 - chromosome 1 open reading frame 226 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NOS1AP - nitric oxide synthase 1 adaptor protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |