Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCTCCCGCCCCCTCAGGCCTGATC[A/G]GGGCCCTTGGAGTCTTGGTCCTGAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
4 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 609613 MIM: 610817 | ||||||||||||||||||||
Literature Links: |
PLEKHM2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PLEKHM2 - pleckstrin homology and RUN domain containing M2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC25A34 - solute carrier family 25 member 34 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM82 - transmembrane protein 82 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001013641.2 | 165 | Missense Mutation | AGG,GGG | R,G 33 | NP_001013663.1 |