Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCTATGTGGGATCCTGTCTGGCTC[A/G]CTTAGGATTCTGCAGGTCACCAGGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
3 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 602784 MIM: 601882 | ||||||||||||||||||||
Literature Links: |
APITD1-CORT PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
APITD1-CORT - APITD1-CORT readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CORT - cortistatin | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DFFA - DNA fragmentation factor subunit alpha | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004401.2 | 1071 | Missense Mutation | NP_004392.1 | |||
NM_213566.1 | 1071 | UTR 3 | NP_998731.1 |