Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGTACGTATTTTTCCAGGAAGCTGC[A/G]GTTCTGGAACCTGGAGTTTGAGAGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
14 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611354 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ACAP3 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ACAP3 - ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CPSF3L - cleavage and polyadenylation specific factor 3-like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256456.1 | 683 | Intron | NP_001243385.1 | |||
NM_001256460.1 | 683 | Intron | NP_001243389.1 | |||
NM_001256462.1 | 683 | Intron | NP_001243391.1 | |||
NM_001256463.1 | 683 | Intron | NP_001243392.1 | |||
NM_017871.5 | 683 | Intron | NP_060341.2 | |||
XM_011541647.1 | 683 | Intron | XP_011539949.1 | |||
XM_011541648.1 | 683 | Intron | XP_011539950.1 | |||
XM_011541650.1 | 683 | Intron | XP_011539952.1 | |||
XM_017001557.1 | 683 | Intron | XP_016857046.1 | |||
XM_017001558.1 | 683 | Intron | XP_016857047.1 |
MIR6727 - microRNA 6727 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PUSL1 - pseudouridylate synthase-like 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_153339.1 | 683 | Missense Mutation | CAG,CGG | Q,R 218 | NP_699170.1 | |
XM_005244720.3 | 683 | Missense Mutation | AGT,GGT | S,G 210 | XP_005244777.1 |