Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCACGTCGGGTGTCTCAGAGCCCC[A/T]GTCCCCTACCCGGATCCCCTGGAGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
10 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 112260 MIM: 614579 MIM: 609176 MIM: 610962 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
BGLAP PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
BGLAP - bone gamma-carboxyglutamate protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_199173.5 | 512 | Silent Mutation | CCA,CCT | P,P 60 | NP_954642.1 |
PAQR6 - progestin and adipoQ receptor family member 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001272104.1 | 512 | Intron | NP_001259033.1 | |||
NM_001272105.1 | 512 | Intron | NP_001259034.1 | |||
NM_001272106.1 | 512 | Intron | NP_001259035.1 | |||
NM_001272107.1 | 512 | Intron | NP_001259036.1 | |||
NM_001272108.1 | 512 | Intron | NP_001259037.1 | |||
NM_001272109.1 | 512 | Intron | NP_001259038.1 | |||
NM_001272110.1 | 512 | Intron | NP_001259039.1 | |||
NM_001272111.1 | 512 | Intron | NP_001259040.1 | |||
NM_001272112.1 | 512 | Intron | NP_001259041.1 | |||
NM_001272113.1 | 512 | Intron | NP_001259042.1 | |||
NM_024897.3 | 512 | Intron | NP_079173.2 | |||
NM_198406.2 | 512 | Intron | NP_940798.1 | |||
XM_005245494.3 | 512 | Intron | XP_005245551.1 | |||
XM_006711546.2 | 512 | Intron | XP_006711609.1 | |||
XM_006711547.3 | 512 | Intron | XP_006711610.1 | |||
XM_006711548.3 | 512 | Intron | XP_006711611.1 | |||
XM_006711552.2 | 512 | Intron | XP_006711615.1 | |||
XM_006711553.3 | 512 | Intron | XP_006711616.1 | |||
XM_011510000.2 | 512 | Intron | XP_011508302.1 | |||
XM_017002385.1 | 512 | Intron | XP_016857874.1 |
PMF1 - polyamine-modulated factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PMF1-BGLAP - PMF1-BGLAP readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001199661.1 | 512 | Missense Mutation | AGT,TGT | S,C 207 | NP_001186590.1 | |
NM_001199662.1 | 512 | UTR 3 | NP_001186591.1 | |||
NM_001199663.1 | 512 | Missense Mutation | AGT,TGT | S,C 162 | NP_001186592.1 | |
NM_001199664.1 | 512 | UTR 3 | NP_001186593.1 |
SMG5 - SMG5, nonsense mediated mRNA decay factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |