Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATCACAGCGCTGAGCGTTGCTCGC[C/T]ACTGGGTGGTGGCCATGGCTGCGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
6 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 607560 MIM: 609043 | ||||||||||||||||||||
Literature Links: |
ARHGEF2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARHGEF2 - Rho/Rac guanine nucleotide exchange factor 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KIAA0907 - KIAA0907 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6738 - microRNA 6738 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RXFP4 - relaxin/insulin like family peptide receptor 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_181885.2 | 439 | Missense Mutation | CAC,TAC | H,Y 140 | NP_871001.1 |