Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGTGGAAAACCACAAAATGCGCCA[A/G]AGGGTAAGACCCGAAGTTCCTGGTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
3 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 603618 MIM: 611813 MIM: 159530 | ||||||||||||||||||||
Literature Links: |
CDC20 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CDC20 - cell division cycle 20 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001255.2 | Intron | NP_001246.2 |
ELOVL1 - ELOVL fatty acid elongase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6734 - microRNA 6734 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MPL - MPL proto-oncogene, thrombopoietin receptor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |