Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCATTTGAAGCCTCGGGAGCCTTAG[C/T]AGCAGTGGCGACTGCTATGCCGGCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
13 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606168 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
DDX20 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DDX20 - DEAD-box helicase 20 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_007204.4 | 392 | Missense Mutation | GCA,GTA | A,V 12 | NP_009135.4 |
FAM212B - family with sequence similarity 212 member B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_019099.4 | 392 | Intron | NP_061972.1 | |||
NM_198926.2 | 392 | Intron | NP_945120.1 | |||
XM_011541783.2 | 392 | Intron | XP_011540085.1 |
FAM212B-AS1 - FAM212B antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101928718 - uncharacterized LOC101928718 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |