Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGCAGTTTGCCTACACGGCTGAGA[C/T]TGTGGTGGGCGAGGGCAATGTGCAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 610770 | ||||||||||||||||||||
Literature Links: |
KLHL17 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KLHL17 - kelch like family member 17 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_198317.2 | 1055 | Missense Mutation | ACT,ATT | T,I 155 | NP_938073.1 | |
XM_006710600.3 | 1055 | Missense Mutation | ACT,ATT | T,I 155 | XP_006710663.1 | |
XM_006710601.3 | 1055 | Missense Mutation | ACT,ATT | T,I 155 | XP_006710664.1 |
NOC2L - NOC2 like nucleolar associated transcriptional repressor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PLEKHN1 - pleckstrin homology domain containing N1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |