Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTTGAGATTCTTTGCCCAGTGTTA[A/G]GAAGATATATCCCTTTGACACTGGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
10 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605344 MIM: 611600 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
NFYC PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
NFYC - nuclear transcription factor Y subunit gamma | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001142587.1 | Intron | NP_001136059.1 | ||||
NM_001142588.1 | Intron | NP_001136060.1 | ||||
NM_001142589.1 | Intron | NP_001136061.1 | ||||
NM_001142590.1 | Intron | NP_001136062.1 | ||||
NM_001308114.1 | Intron | NP_001295043.1 | ||||
NM_001308115.1 | Intron | NP_001295044.1 | ||||
NM_014223.4 | Intron | NP_055038.2 | ||||
XM_005270894.1 | Intron | XP_005270951.1 | ||||
XM_005270895.3 | Intron | XP_005270952.3 | ||||
XM_006710658.2 | Intron | XP_006710721.2 | ||||
XM_006710660.2 | Intron | XP_006710723.2 | ||||
XM_006710661.1 | Intron | XP_006710724.1 | ||||
XM_006710662.2 | Intron | XP_006710725.2 | ||||
XM_011541516.1 | Intron | XP_011539818.1 | ||||
XM_011541517.1 | Intron | XP_011539819.1 | ||||
XM_017001364.1 | Intron | XP_016856853.1 | ||||
XM_017001365.1 | Intron | XP_016856854.1 | ||||
XM_017001366.1 | Intron | XP_016856855.1 | ||||
XM_017001367.1 | Intron | XP_016856856.1 | ||||
XM_017001368.1 | Intron | XP_016856857.1 | ||||
XM_017001369.1 | Intron | XP_016856858.1 |
NFYC-AS1 - NFYC antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RIMS3 - regulating synaptic membrane exocytosis 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |