Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GACACAGTGTTCTCCATGTCTCCCT[C/T]ATCCTGGGGCTGCCCACAGCCCAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 607646 | ||||||||||||||||||||
Literature Links: |
DCST1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DCST1 - DC-STAMP domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DCST2 - DC-STAMP domain containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_144622.2 | 1365 | Missense Mutation | AAG,GAG | K,E 608 | NP_653223.2 | |
XM_011509188.2 | 1365 | Missense Mutation | AAG,GAG | K,E 388 | XP_011507490.1 | |
XM_011509189.2 | 1365 | Missense Mutation | AAG,GAG | K,E 276 | XP_011507491.1 |
ZBTB7B - zinc finger and BTB domain containing 7B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |