Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGACAGCAGCGTTGGCAAAATGATC[A/G]GGCAAGCAACTGCAGCAGACCAGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
3 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 604684 | ||||||||||||||||||||
Literature Links: |
CDC42SE1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CDC42SE1 - CDC42 small effector 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GABPB2 - GA binding protein transcription factor beta subunit 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MLLT11 - myeloid/lymphoid or mixed-lineage leukemia; translocated to, 11 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006818.3 | 1033 | Missense Mutation | AGG,GGG | R,G 50 | NP_006809.1 |