Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAAGGAGGAAGGGTTCTGACTGTGC[C/T]CTTTCTGAACTGGCCCTTGAGGTTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
14 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 611923 MIM: 606535 | ||||||||||||||||||||
Literature Links: |
GJA9 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GJA9 - gap junction protein alpha 9 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_030772.4 | 1638 | Missense Mutation | AGC,GGC | S,G 450 | NP_110399.2 |
GJA9-MYCBP - GJA9-MYCBP readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105378663 - uncharacterized LOC105378663 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MYCBP - MYC binding protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |