Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACGAGAATGGAGACGGGGAGGTGGA[C/T]TTCCAGGAGTATGTGGTGCTTGTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 614206 MIM: 176940 MIM: 601989 | ||||||||||||||||||||
Literature Links: |
CHTOP PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CHTOP - chromatin target of PRMT1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
S100A1 - S100 calcium binding protein A1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006271.1 | 326 | Silent Mutation | GAC,GAT | D,D 71 | NP_006262.1 |
S100A13 - S100 calcium binding protein A13 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001024210.1 | 326 | Intron | NP_001019381.1 | |||
NM_001024211.1 | 326 | Intron | NP_001019382.1 | |||
NM_001024212.1 | 326 | Intron | NP_001019383.1 | |||
NM_001024213.1 | 326 | Intron | NP_001019384.1 | |||
NM_005979.2 | 326 | Intron | NP_005970.1 | |||
XM_005245434.3 | 326 | Intron | XP_005245491.1 | |||
XM_011509862.2 | 326 | Intron | XP_011508164.1 | |||
XM_011509863.2 | 326 | Intron | XP_011508165.1 | |||
XM_011509864.1 | 326 | Intron | XP_011508166.1 | |||
XM_017002034.1 | 326 | Intron | XP_016857523.1 | |||
XM_017002035.1 | 326 | Intron | XP_016857524.1 | |||
XM_017002036.1 | 326 | Intron | XP_016857525.1 |