Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTCGATGATCGTGTGTCGGATGAG[A/G]AGAAGGTAAGGGGTCCGCCTCTCTC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
24 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 601580 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CAPZA1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CAPZA1 - capping actin protein of muscle Z-line alpha subunit 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006135.2 | 426 | Missense Mutation | AAG,GAG | K,E 12 | NP_006126.1 | |
XM_011542225.2 | 426 | Intron | XP_011540527.1 | |||
XM_017002424.1 | 426 | Intron | XP_016857913.1 |
ST7L - suppression of tumorigenicity 7 like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001308264.1 | 426 | Intron | NP_001295193.1 | |||
NM_017744.4 | 426 | Intron | NP_060214.2 | |||
NM_138727.3 | 426 | Intron | NP_620055.1 | |||
NM_138728.2 | 426 | Intron | NP_620056.1 | |||
NM_138729.3 | 426 | Intron | NP_620057.1 | |||
XM_005270963.4 | 426 | Intron | XP_005271020.1 | |||
XM_005270964.3 | 426 | Intron | XP_005271021.1 | |||
XM_011541627.2 | 426 | Intron | XP_011539929.1 | |||
XM_011541628.2 | 426 | Intron | XP_011539930.1 | |||
XM_011541629.2 | 426 | Intron | XP_011539931.1 | |||
XM_011541630.2 | 426 | Intron | XP_011539932.1 | |||
XM_011541631.2 | 426 | Intron | XP_011539933.1 | |||
XM_017001534.1 | 426 | Intron | XP_016857023.1 | |||
XM_017001535.1 | 426 | Intron | XP_016857024.1 | |||
XM_017001536.1 | 426 | Intron | XP_016857025.1 | |||
XM_017001537.1 | 426 | Intron | XP_016857026.1 | |||
XM_017001538.1 | 426 | Intron | XP_016857027.1 |