Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAACCAAACTTCTGGTTTTTATACC[A/G]TCGTTTAGCACTGGGCCTGGAAAAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
20 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 614259 MIM: 614443 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CFAP57 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CFAP57 - cilia and flagella associated protein 57 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EBNA1BP2 - EBNA1 binding protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001159936.1 | 1038 | Missense Mutation | CGG,TGG | R,W 297 | NP_001153408.1 | |
NM_006824.2 | 1038 | Missense Mutation | CGG,TGG | R,W 242 | NP_006815.2 |
FAM183A - family with sequence similarity 183 member A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6733 - microRNA 6733 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |