Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGTCACCCACATGTAGGGTCAGCTT[C/T]GAGCTAGAGTAGCCAATGGCCATGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
6 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 605960 MIM: 605102 MIM: 182891 | ||||||||||||||||||||
Literature Links: |
EXOSC10 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EXOSC10 - exosome component 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MASP2 - mannan binding lectin serine peptidase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SRM - spermidine synthase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003132.2 | 532 | Silent Mutation | TCA,TCG | S,S 147 | NP_003123.2 | |
XM_017002179.1 | 532 | Silent Mutation | TCA,TCG | S,S 147 | XP_016857668.1 |