Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATCACATTGTTCTGTATCTACTCGT[G/C]ATCTCCCAGGAATCACAGCAGCAGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
3 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 605987 | ||||||||||||||||||||
Literature Links: |
MIR6736 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR6736 - microRNA 6736 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NUDT17 - nudix hydrolase 17 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001012758.2 | 1220 | Silent Mutation | GTC,GTG | V,V 188 | NP_001012776.1 | |
XM_011509260.2 | 1220 | Silent Mutation | GTC,GTG | V,V 118 | XP_011507562.1 | |
XM_011509262.1 | 1220 | Silent Mutation | GTC,GTG | V,V 188 | XP_011507564.1 | |
XM_017000560.1 | 1220 | Intron | XP_016856049.1 |
PIAS3 - protein inhibitor of activated STAT 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
POLR3C - RNA polymerase III subunit C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |