Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAAGCAAAGACCCCTCTGCACCGGC[A/G]AGCCAGCACCCCACTGCCCCTGTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610388 | ||||||||||||||||||||
Literature Links: |
DEFB124 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DEFB124 - defensin beta 124 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LINC00028 - long intergenic non-protein coding RNA 28 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
REM1 - RRAD and GEM like GTPase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014012.5 | 345 | Missense Mutation | CAA,CGA | Q,R 16 | NP_054731.2 | |
XM_005260404.1 | 345 | Missense Mutation | CAA,CGA | Q,R 16 | XP_005260461.1 | |
XM_011528795.1 | 345 | Missense Mutation | CAA,CGA | Q,R 16 | XP_011527097.1 | |
XM_017027833.1 | 345 | Missense Mutation | CAA,CGA | Q,R 16 | XP_016883322.1 |