Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTTTTGGCCTCTCCTTTGGGCCTA[A/G]GCATCATCCAAAGAGACAGCCTCGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606577 | ||||||||||||||||||||
Literature Links: |
C20orf24 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C20orf24 - chromosome 20 open reading frame 24 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLA2 - Src like adaptor 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032214.3 | 1156 | Silent Mutation | GCC,GCT | A,A 261 | NP_115590.1 | |
NM_175077.2 | 1156 | UTR 3 | NP_778252.1 | |||
XM_017028098.1 | 1156 | Intron | XP_016883587.1 |
TGIF2-C20orf24 - TGIF2-C20orf24 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |