Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGGCCTCGGCCTTGCAGCTGGAGA[A/G]AATCAGCGTGTACTACAACGAAGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606153 MIM: 612901 | ||||||||||||||||||||
Literature Links: |
ATP5E PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATP5E - ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLMO2-ATP5E - SLMO2-ATP5E readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TUBB1 - tubulin beta 1 class VI | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_030773.3 | 600 | Missense Mutation | AAA,AGA | K,R 46 | NP_110400.1 | |
XM_017028085.1 | 600 | Missense Mutation | AAA,AGA | K,R 24 | XP_016883574.1 |