Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGAGAATCCCAAAGGACCAGACGT[C/T]GGATTTGGTGGAGTAATGGCCTCGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602004 | ||||||||||||||||||||
Literature Links: |
PPDPF PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PPDPF - pancreatic progenitor cell differentiation and proliferation factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PTK6 - protein tyrosine kinase 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256358.1 | 1039 | UTR 3 | NP_001243287.1 | |||
NM_005975.3 | 1039 | Missense Mutation | AAC,GAC | N,D 369 | NP_005966.1 | |
XM_017027982.1 | 1039 | Intron | XP_016883471.1 |
SRMS - src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |