Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTGCCTCTCCAGTTCCTGGTGGTG[G/T]TCTGCCTAGCACTGCAGCTGGTGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
MIR3617 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR3617 - microRNA 3617 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WFDC10B - WAP four-disulfide core domain 10B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_172006.2 | 145 | Intron | NP_742003.1 | |||
NM_172131.2 | 145 | Intron | NP_742143.1 | |||
XM_017027824.1 | 145 | Intron | XP_016883313.1 | |||
XM_017027825.1 | 145 | Intron | XP_016883314.1 |
WFDC13 - WAP four-disulfide core domain 13 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_172005.1 | 145 | Missense Mutation | GTC,TTC | V,F 13 | NP_742002.1 |
WFDC3 - WAP four-disulfide core domain 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |