Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCGGCTCCATGGTGGCCTCCCTGC[A/T]CTCCTTCCAGCGCCGCTGGATAACT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 189971 MIM: 612478 | ||||||||||||||||||||
Literature Links: |
ACTL10 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ACTL10 - actin like 10 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001024675.1 | 1659 | Missense Mutation | CAC,CTC | H,L 220 | NP_001019846.1 |
C20orf144 - chromosome 20 open reading frame 144 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
E2F1 - E2F transcription factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NECAB3 - N-terminal EF-hand calcium binding protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_031231.3 | 1659 | Intron | NP_112508.3 | |||
NM_031232.3 | 1659 | Intron | NP_112509.3 | |||
XM_005260510.1 | 1659 | Intron | XP_005260567.1 | |||
XM_011528991.1 | 1659 | Intron | XP_011527293.1 | |||
XM_011528992.2 | 1659 | Intron | XP_011527294.1 | |||
XM_017028015.1 | 1659 | Intron | XP_016883504.1 | |||
XM_017028016.1 | 1659 | Intron | XP_016883505.1 |