Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAGCCGCTCGACCTTCTCCCGACC[C/T]TGGATCTGAGGCAGGAGATGCCTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604205 MIM: 603038 | ||||||||||||||||||||
Literature Links: |
CPNE1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CPNE1 - copine 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FER1L4 - fer-1 like family member 4, pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPAG4 - sperm associated antigen 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001317931.1 | 124 | Silent Mutation | CTG,TTG | L,L 43 | NP_001304860.1 | |
NM_003116.2 | 124 | Silent Mutation | CTG,TTG | L,L 120 | NP_003107.1 | |
XM_005260520.4 | 124 | Silent Mutation | CTG,TTG | L,L 27 | XP_005260577.1 | |
XM_011529009.2 | 124 | Silent Mutation | CTG,TTG | L,L 76 | XP_011527311.1 |