Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGCAGGGCCCCACGGTGCTCTCGAG[A/G]GACAACTGGGATGCCTGCCGGAGCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607368 MIM: 611601 | ||||||||||||||||||||
Literature Links: |
KCNK15 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KCNK15 - potassium two pore domain channel subfamily K member 15 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KCNK15-AS1 - KCNK15 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RIMS4 - regulating synaptic membrane exocytosis 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001205317.1 | 838 | Silent Mutation | TCC,TCT | S,S 258 | NP_001192246.1 | |
NM_182970.3 | 838 | Silent Mutation | TCC,TCT | S,S 257 | NP_892015.1 |