Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGCCTTCCAGCGAGTTCCAAATCA[A/G]CGTGGTAGACTGCCAGCCTGTTCAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613842 MIM: 605811 | ||||||||||||||||||||
Literature Links: |
GZF1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GZF1 - GDNF inducible zinc finger protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LINC01431 - long intergenic non-protein coding RNA 1431 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NXT1 - nuclear transport factor 2 like export factor 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_013248.2 | 374 | Missense Mutation | AAC,AGC | N,S 73 | NP_037380.1 | |
XM_011529230.2 | 374 | Missense Mutation | AAC,AGC | N,S 73 | XP_011527532.1 |