Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAATGTGTTGCAGCTCCTGGTCGGT[A/G]GTATTGTTGGGTACCAGGAGACCGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602912 MIM: 604871 | ||||||||||||||||||||
Literature Links: |
EIF6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EIF6 - eukaryotic translation initiation factor 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001267810.1 | 458 | Silent Mutation | ACC,ACT | T,T 76 | NP_001254739.1 | |
NM_002212.3 | 458 | Silent Mutation | ACC,ACT | T,T 76 | NP_002203.1 | |
NM_181466.2 | 458 | Intron | NP_852131.1 | |||
NM_181468.2 | 458 | Silent Mutation | ACC,ACT | T,T 76 | NP_852133.1 |
FAM83C - family with sequence similarity 83 member C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FAM83C-AS1 - FAM83C antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MMP24 - matrix metallopeptidase 24 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MMP24-AS1 - MMP24 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |