Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGGGCAGCTCCGGGCTCAGGAAGC[C/T]GGCCTGCAGCAGGAGCAGAGGAAGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609809 MIM: 609493 MIM: 614639 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LIME1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LIME1 - Lck interacting transmembrane adaptor 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001305654.1 | 1649 | UTR 5 | NP_001292583.1 | |||
NM_001305655.1 | 1649 | Intron | NP_001292584.1 | |||
NM_017806.3 | 1649 | Intron | NP_060276.2 |
SLC2A4RG - SLC2A4 regulator | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZBTB46 - zinc finger and BTB domain containing 46 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZGPAT - zinc finger CCCH-type and G-patch domain containing | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001083113.1 | 1649 | Silent Mutation | GCC,GCT | A,A 493 | NP_001076582.1 | |
NM_001195653.1 | 1649 | Silent Mutation | GCC,GCT | A,A 493 | NP_001182582.1 | |
NM_001195654.1 | 1649 | Silent Mutation | GCC,GCT | A,A 484 | NP_001182583.1 | |
NM_032527.4 | 1649 | Silent Mutation | GCC,GCT | A,A 513 | NP_115916.3 | |
NM_181485.2 | 1649 | Silent Mutation | GCC,GCT | A,A 493 | NP_852150.2 |