Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACAGATCTACAAAGTTCTTCAATGT[C/G]TGCGGAACAAAGACAAGAAGCAGAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
ANKEF1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ANKEF1 - ankyrin repeat and EF-hand domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001303472.1 | 501 | UTR 5 | NP_001290401.1 | |||
NM_022096.5 | 501 | Missense Mutation | CTG,GTG | L,V 20 | NP_071379.3 | |
NM_198798.2 | 501 | Missense Mutation | CTG,GTG | L,V 20 | NP_942093.1 | |
XM_005260792.2 | 501 | Intron | XP_005260849.1 |
SNAP25-AS1 - SNAP25 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |