Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCACCCGAGCTGCTGGCTGCTGCC[A/G]GCTTCTTCCACACAGGTCAGTCCCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605737 MIM: 612873 | ||||||||||||||||||||
Literature Links: |
BIRC7 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BIRC7 - baculoviral IAP repeat containing 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_022161.3 | 548 | Missense Mutation | AGC,GGC | S,G 112 | NP_071444.1 | |
NM_139317.2 | 548 | Missense Mutation | AGC,GGC | S,G 112 | NP_647478.1 |
LOC107985425 - uncharacterized LOC107985425 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR3196 - microRNA 3196 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NKAIN4 - Na+/K+ transporting ATPase interacting 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |