Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCAGGCCACCAAAGCCTCCACAGCC[A/G]TAGCCCAGGCCTCCATAGTAGCTGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
KRTAP19-2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KRTAP19-2 - keratin associated protein 19-2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KRTAP19-3 - keratin associated protein 19-3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_181609.3 | 39 | Silent Mutation | TAC,TAT | Y,Y 13 | NP_853640.1 |
KRTAP19-4 - keratin associated protein 19-4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KRTAP19-5 - keratin associated protein 19-5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |