Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGACCAAGATAGACCCCAGCGCCT[C/T]GGTGCAGAAGCTGGAGCTGGACGTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
FAM207A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAM207A - family with sequence similarity 207 member A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001316983.1 | 397 | Intron | NP_001303912.1 | |||
NM_001316984.1 | 397 | Intron | NP_001303913.1 | |||
NM_001316985.1 | 397 | Intron | NP_001303914.1 | |||
NM_001316986.1 | 397 | Intron | NP_001303915.1 | |||
NM_001316987.1 | 397 | Intron | NP_001303916.1 | |||
NM_001316988.1 | 397 | Intron | NP_001303917.1 | |||
NM_058190.3 | 397 | Intron | NP_478070.1 | |||
XM_017028481.1 | 397 | UTR 5 | XP_016883970.1 | |||
XM_017028482.1 | 397 | Intron | XP_016883971.1 |
LINC01547 - long intergenic non-protein coding RNA 1547 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |