Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACGGGAGAGGAGGAAGGGCTCGGGA[A/C]GGTCGGCTCGCCGAGCCAACCAGGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604297 | ||||||||||||||||||||
Literature Links: |
PAXBP1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PAXBP1 - PAX3 and PAX7 binding protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PAXBP1-AS1 - PAXBP1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SYNJ1 - synaptojanin 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001160302.1 | Intron | NP_001153774.1 | ||||
NM_001160306.1 | Intron | NP_001153778.1 | ||||
NM_003895.3 | Intron | NP_003886.3 | ||||
NM_203446.2 | Intron | NP_982271.2 | ||||
XM_017028494.1 | Intron | XP_016883983.1 | ||||
XM_017028495.1 | Intron | XP_016883984.1 | ||||
XM_017028496.1 | Intron | XP_016883985.1 | ||||
XM_017028497.1 | Intron | XP_016883986.1 | ||||
XM_017028498.1 | Intron | XP_016883987.1 | ||||
XM_017028499.1 | Intron | XP_016883988.1 | ||||
XM_017028500.1 | Intron | XP_016883989.1 | ||||
XM_017028501.1 | Intron | XP_016883990.1 | ||||
XM_017028502.1 | Intron | XP_016883991.1 | ||||
XM_017028503.1 | Intron | XP_016883992.1 | ||||
XM_017028504.1 | Intron | XP_016883993.1 | ||||
XM_017028505.1 | Intron | XP_016883994.1 |