Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGCTTGCCTGTGTCACTGTCAGGA[A/T]TTGTCTAGCGGCGCATTCCCTGACA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602230 | ||||||||||||||||||||
Literature Links: |
LCA5L PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LCA5L - LCA5L, lebercilin like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6508 - microRNA 6508 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SH3BGR - SH3 domain binding glutamate rich protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001001713.1 | 180 | Intron | NP_001001713.1 | |||
NM_001317740.1 | 180 | Missense Mutation | GAA,GAT | E,D 42 | NP_001304669.1 | |
NM_001317741.1 | 180 | Intron | NP_001304670.1 | |||
NM_001317742.1 | 180 | Intron | NP_001304671.1 | |||
NM_007341.2 | 180 | Missense Mutation | GAA,GAT | E,D 42 | NP_031367.1 |
WRB-SH3BGR - WRB-SH3BGR readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001317744.1 | 180 | Intron | NP_001304673.1 |