Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCGGGAGGAGATTGACAAGTTTGG[A/G]ATCCATGTATACCAGTTCCCTGAGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 138720 MIM: 602724 | ||||||||||||||||||||
Literature Links: |
GP1BB PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GP1BB - glycoprotein Ib platelet beta subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SEPT5 - septin 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001009939.2 | 972 | Silent Mutation | GGA,GGG | G,G 223 | NP_001009939.1 | |
NM_002688.5 | 972 | Silent Mutation | GGA,GGG | G,G 214 | NP_002679.2 |
SEPT5-GP1BB - SEPT5-GP1BB readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |