Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGGACCTATGGACAGTGCGCTGCT[C/G]TGGACAGCACTGGGAGCGTGAGGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613682 MIM: 607551 | ||||||||||||||||||||
Literature Links: |
CCDC116 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CCDC116 - coiled-coil domain containing 116 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR130B - microRNA 130b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR301B - microRNA 301b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SDF2L1 - stromal cell derived factor 2 like 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_022044.2 | 533 | Missense Mutation | TCT,TGT | S,C 150 | NP_071327.2 |