Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGATTGACCAGAAAGTGTATGAGCT[A/G]CAGGCCAGTCGTGTCTCCAGTGATG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613383 MIM: 613556 | ||||||||||||||||||||
Literature Links: |
ANKRD54 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ANKRD54 - ankyrin repeat domain 54 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EIF3L - eukaryotic translation initiation factor 3 subunit L | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001242923.1 | 300 | Silent Mutation | CTA,CTG | L,L 74 | NP_001229852.1 | |
NM_016091.3 | 300 | Silent Mutation | CTA,CTG | L,L 74 | NP_057175.1 | |
XM_005261625.1 | 300 | Intron | XP_005261682.1 | |||
XM_006724260.3 | 300 | Silent Mutation | CTA,CTG | L,L 117 | XP_006724323.1 | |
XM_017028814.1 | 300 | Intron | XP_016884303.1 |
MIR658 - microRNA 658 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR659 - microRNA 659 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |