Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAGTATACTGTGGTCTGTGGGTCA[C/T]GGCAATTGGGGTTTGAATCTAGGTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604877 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MAFF PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MAFF - MAF bZIP transcription factor F | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA92 - small nucleolar RNA, H/ACA box 92 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM184B - transmembrane protein 184B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001195071.1 | Intron | NP_001182000.1 | ||||
NM_001195072.1 | Intron | NP_001182001.1 | ||||
NM_012264.4 | Intron | NP_036396.2 | ||||
XM_011530112.2 | Intron | XP_011528414.2 | ||||
XM_011530113.1 | Intron | XP_011528415.1 | ||||
XM_011530114.1 | Intron | XP_011528416.1 | ||||
XM_011530115.2 | Intron | XP_011528417.1 | ||||
XM_011530116.2 | Intron | XP_011528418.2 | ||||
XM_011530117.1 | Intron | XP_011528419.1 | ||||
XM_011530118.1 | Intron | XP_011528420.1 | ||||
XM_011530119.1 | Intron | XP_011528421.1 | ||||
XM_017028754.1 | Intron | XP_016884243.1 | ||||
XM_017028755.1 | Intron | XP_016884244.1 | ||||
XM_017028756.1 | Intron | XP_016884245.1 | ||||
XM_017028757.1 | Intron | XP_016884246.1 | ||||
XM_017028758.1 | Intron | XP_016884247.1 | ||||
XM_017028759.1 | Intron | XP_016884248.1 |