Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAAGGCGCGGAGTCAACCTTCCCCT[A/G]TGCTGCCGCTGCCTGTAGCTGAGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616456 MIM: 601336 MIM: 606961 | ||||||||||||||||||||
Literature Links: |
INO80B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
INO80B - INO80 complex subunit B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_031288.3 | 674 | Missense Mutation | ATG,GTG | M,V 194 | NP_112578.2 |
INO80B-WBP1 - INO80B-WBP1 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MOGS - mannosyl-oligosaccharide glucosidase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WBP1 - WW domain binding protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |