Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAGGAAACAGCAGGAATCTTGGCAC[A/G]TAGAGGGTCTGTTGTGGCCCCTGCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612204 MIM: 604719 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ANKZF1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ANKZF1 - ankyrin repeat and zinc finger domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001042410.1 | 1549 | Intron | NP_001035869.1 | |||
NM_001282792.1 | 1549 | Intron | NP_001269721.1 | |||
NM_018089.2 | 1549 | Intron | NP_060559.2 | |||
XM_005246663.2 | 1549 | Intron | XP_005246720.1 | |||
XM_011511392.2 | 1549 | Intron | XP_011509694.1 | |||
XM_017004420.1 | 1549 | Intron | XP_016859909.1 | |||
XM_017004421.1 | 1549 | Intron | XP_016859910.1 |
ATG9A - autophagy related 9A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GLB1L - galactosidase beta 1 like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286423.1 | 1549 | Silent Mutation | NP_001273352.1 | |||
NM_001286427.1 | 1549 | Silent Mutation | NP_001273356.1 | |||
NM_024506.4 | 1549 | Silent Mutation | NP_078782.3 | |||
XM_011511813.2 | 1549 | Silent Mutation | XP_011510115.1 | |||
XM_017004895.1 | 1549 | Silent Mutation | XP_016860384.1 |
STK16 - serine/threonine kinase 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |