Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCCATCAGAGTCCACACAATTGTT[A/G]TATCTGTTCAGCATGATGAAGAGGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 137167 MIM: 601468 MIM: 616350 | ||||||||||||||||||||
Literature Links: |
GGCX PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GGCX - gamma-glutamyl carboxylase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAT2A - methionine adenosyltransferase 2A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005911.5 | 923 | Missense Mutation | ATA,GTA | I,V 205 | NP_005902.1 |
PARTICL - promoter of MAT2A antisense radiation-induced circulating long non-coding RNA | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |