Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAGGATTCAGGACTGGTTCCCAGGC[A/C]GGAAAAAAACGGCAGGTGCCAACGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601336 MIM: 611857 | ||||||||||||||||||||
Literature Links: |
CCDC142 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CCDC142 - coiled-coil domain containing 142 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032779.3 | 2599 | Missense Mutation | GGC,TGC | G,C 736 | NP_116168.3 |
MOGS - mannosyl-oligosaccharide glucosidase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRPL53 - mitochondrial ribosomal protein L53 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TTC31 - tetratricopeptide repeat domain 31 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |