Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCGAGAGGATGAACAACAAGTTCGA[C/T]GCGTGAGTGGCTCGTGGCCGCCCCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 100730 MIM: 605895 MIM: 612972 | ||||||||||||||||||||
Literature Links: |
CHRNG PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CHRNG - cholinergic receptor nicotinic gamma subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EIF4E2 - eukaryotic translation initiation factor 4E family member 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001276336.1 | 156 | Silent Mutation | GAC,GAT | D,D 6 | NP_001263265.1 | |
NM_001276337.1 | 156 | Silent Mutation | GAC,GAT | D,D 6 | NP_001263266.1 | |
NM_001282958.1 | 156 | Silent Mutation | GAC,GAT | D,D 6 | NP_001269887.1 | |
NM_004846.3 | 156 | Silent Mutation | GAC,GAT | D,D 6 | NP_004837.1 | |
XM_005246975.3 | 156 | Silent Mutation | GAC,GAT | D,D 6 | XP_005247032.1 | |
XM_011512206.2 | 156 | Intron | XP_011510508.1 | |||
XM_017005377.1 | 156 | Silent Mutation | GAC,GAT | D,D 6 | XP_016860866.1 |
MIR5001 - microRNA 5001 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TIGD1 - tigger transposable element derived 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_145702.2 | 156 | Intron | NP_663748.1 |