Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTTCCTCGCTTAAAAAGTAGCTTT[C/G]AAAACAGGGGCCCATTGATGTCACC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607835 MIM: 605171 | ||||||||||||||||||||
Literature Links: |
FAM228B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAM228B - family with sequence similarity 228 member B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145710.1 | 1245 | Intron | NP_001139182.1 | |||
NM_001291328.1 | 1245 | Intron | NP_001278257.1 |
SF3B6 - splicing factor 3b subunit 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TP53I3 - tumor protein p53 inducible protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001206802.2 | 1245 | Intron | NP_001193731.1 | |||
NM_004881.4 | 1245 | Nonsense Mutation | TCA,TGA | S,* 252 | NP_004872.2 | |
NM_147184.3 | 1245 | Nonsense Mutation | TCA,TGA | S,* 252 | NP_671713.1 | |
XM_005264650.2 | 1245 | Nonsense Mutation | TCA,TGA | S,* 163 | XP_005264707.1 | |
XM_006712150.2 | 1245 | Intron | XP_006712213.1 |