Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCTCCTGAAGAATTCGTGATACCA[A/G]AGATGAGCTAGAGTGAATGAAGAGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606687 MIM: 604883 MIM: 605963 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
EIF2B4 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
EIF2B4 - eukaryotic translation initiation factor 2B subunit delta | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001034116.1 | 1161 | Silent Mutation | NP_001029288.1 | |||
NM_001318965.1 | 1161 | Silent Mutation | NP_001305894.1 | |||
NM_001318966.1 | 1161 | Silent Mutation | NP_001305895.1 | |||
NM_001318967.1 | 1161 | Silent Mutation | NP_001305896.1 | |||
NM_001318968.1 | 1161 | Silent Mutation | NP_001305897.1 | |||
NM_001318969.1 | 1161 | Silent Mutation | NP_001305898.1 | |||
NM_015636.3 | 1161 | Silent Mutation | NP_056451.3 | |||
NM_172195.3 | 1161 | Silent Mutation | NP_751945.2 | |||
XM_006712132.1 | 1161 | Silent Mutation | XP_006712195.1 | |||
XM_011533147.2 | 1161 | Silent Mutation | XP_011531449.1 |
GTF3C2 - general transcription factor IIIC subunit 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105374363 - uncharacterized LOC105374363 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNX17 - sorting nexin 17 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |