Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCACGGGGAGCCCGCGAAGTTTTA[C/T]GGATACGATAACTTACAGAGACAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 142980 MIM: 142985 MIM: 142982 | ||||||||||||||||||||
Literature Links: |
HOXD-AS2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HOXD-AS2 - HOXD cluster antisense RNA 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HOXD3 - homeobox D3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HOXD8 - homeobox D8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001199746.1 | 1038 | Silent Mutation | TAC,TAT | Y,Y 137 | NP_001186675.1 | |
NM_001199747.1 | 1038 | Intron | NP_001186676.1 | |||
NM_019558.3 | 1038 | Silent Mutation | TAC,TAT | Y,Y 137 | NP_062458.1 |
HOXD9 - homeobox D9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100129455 - uncharacterized LOC100129455 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |