Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AATACCACTGCTTATTACCTATTCA[A/G]GACGAGTGTACTTAGAGCTTCTCCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 118190 MIM: 600141 | ||||||||||||||||||||
Literature Links: |
HSPD1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HSPD1 - heat shock protein family D (Hsp60) member 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002156.4 | Intron | NP_002147.2 | ||||
NM_199440.1 | Intron | NP_955472.1 |
HSPE1 - heat shock protein family E (Hsp10) member 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HSPE1-MOB4 - HSPE1-MOB4 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA105B - small nucleolar RNA, H/ACA box 105B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |