Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTTCAACTCCTTGGCTATGGGGTT[C/G]TGGCTTTAGGTCCATGGGCTCCTTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603647 MIM: 616014 MIM: 607652 MIM: 604083 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
BCS1L PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
BCS1L - BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001079866.1 | 1250 | Intron | NP_001073335.1 | |||
NM_001257342.1 | 1250 | Intron | NP_001244271.1 | |||
NM_001257343.1 | 1250 | Intron | NP_001244272.1 | |||
NM_001257344.1 | 1250 | Intron | NP_001244273.1 | |||
NM_001318836.1 | 1250 | Intron | NP_001305765.1 | |||
NM_001320717.1 | 1250 | Intron | NP_001307646.1 | |||
NM_004328.4 | 1250 | Intron | NP_004319.1 | |||
XM_005246748.2 | 1250 | Intron | XP_005246805.1 | |||
XM_005246749.3 | 1250 | Intron | XP_005246806.1 | |||
XM_006712678.1 | 1250 | Intron | XP_006712741.1 | |||
XM_017004631.1 | 1250 | Intron | XP_016860120.1 | |||
XM_017004632.1 | 1250 | Intron | XP_016860121.1 | |||
XM_017004633.1 | 1250 | Intron | XP_016860122.1 | |||
XM_017004634.1 | 1250 | Intron | XP_016860123.1 |
RNF25 - ring finger protein 25 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_022453.2 | 1250 | Missense Mutation | CAA,GAA | Q,E 388 | NP_071898.2 | |
XM_017004695.1 | 1250 | Missense Mutation | CAA,GAA | Q,E 276 | XP_016860184.1 |
STK36 - serine/threonine kinase 36 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF142 - zinc finger protein 142 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |