Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTCTGGGGTGATGTGGACCCCGGA[A/G]CTGGCAATTCTGAGGGGATTCCCCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605638 | ||||||||||||||||||||
Literature Links: |
BIRC6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BIRC6 - baculoviral IAP repeat containing 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4765 - microRNA 4765 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TTC27 - tetratricopeptide repeat domain 27 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001193509.1 | 288 | Intron | NP_001180438.1 | |||
NM_017735.4 | 288 | Silent Mutation | GAA,GAG | E,E 5 | NP_060205.3 | |
XM_005264416.1 | 288 | Silent Mutation | GAA,GAG | E,E 5 | XP_005264473.1 | |
XM_011532958.1 | 288 | Silent Mutation | GAA,GAG | E,E 5 | XP_011531260.1 |